Sentiment analysis techniquescông việc

Bộ lọc

Tìm kiếm gần đây của tôi
Lọc theo:
Ngân sách
đến
đến
đến
Loại
Nhiều kỹ năng
Ngôn ngữ
    Tình trạng công việc
    168,924 sentiment analysis techniques công việc được tìm thấy, giá theo USD

    I am looking for an experienced Data Scientist who can mentor me 1~2 days a week for 2~3 months (mentoring hours explained later). We will study together online. My mentor should have at least 2 years experienced working as a Data Scientist, and have deep understanding of statistics. My mentor would have examples and documents, to help me learn the followings: - Statistics, including Probability...

    $594 (Avg Bid)
    $594 Giá đặt trung bình
    10 lượt đặt giá

    We're a review management and capture SAAS company. Our specialty is providing a service that allows businesses of all sizes to optimize the number of positive reviews they're receiving from their current customers and how to utilize those online reviews to convert more new customers, all while improving their service through customer feedback. Our website is ReviewTrigger.com. We'...

    $25 - $50 / hr
    $25 - $50 / hr
    0 lượt đặt giá

    I have a Chrome browser extension and I do media buying for getting new people to install it. I have Google Analytics setup and everything is tracked. We monetize it using different methods. I have the data already. However, Data analysis is not my area, and I'm having trouble to find the most profitable zones, to calculate potential ROI, creating metrics, etc.

    $123 (Avg Bid)
    $123 Giá đặt trung bình
    3 lượt đặt giá
    Whole Exome Sequencing data anlysis 6 ngày left
    ĐÃ XÁC THỰC

    We need to do whole exome sequencing data analysis to detect and annotate variants. Code and reference data (preferably cancer-associated) in appropriate formats must be shared.

    $133 (Avg Bid)
    $133 Giá đặt trung bình
    1 lượt đặt giá

    Please message me, I require form a data set, several pivotal tables, and other analysis inclusive of box plots and other data analysis.

    $16 (Avg Bid)
    $16 Giá đặt trung bình
    6 lượt đặt giá

    I need a business plan for a startup. NDA absolute must, need experience and must be able to show recent work relating to business plan and related analysis. Budget and analysis is key as well.

    $372 (Avg Bid)
    $372 Giá đặt trung bình
    7 lượt đặt giá

    Developing a DashboardData analysis and visualization is an important tool in various areas, including engineering, science, medicine, economics, finance and decision making in general. Due to the large amount of data generated everyday, using efficient data structure to store and manipulate data is critical for the successful development of data analysis and visualization applications. Your goal ...

    $83 (Avg Bid)
    $83 Giá đặt trung bình
    9 lượt đặt giá

    Descriptive analysis to predict stock price using Python

    $29 (Avg Bid)
    $29 Giá đặt trung bình
    8 lượt đặt giá

    UPDATE: please DON’T APPLY if your English is IS NOT PERFECT or if you don’t care to read the project description. I can tell by the way your proposal is worded if you can/cannot do this job, so you just wasting your bids. And I'm not a "sir"... Thanks and have a nice day! :) Hi there! I'm looking for a virtual assistant to help me with emailing potential client...

    $41 / hr (Avg Bid)
    $41 / hr Giá đặt trung bình
    30 lượt đặt giá

    I am looking for business proposal draft for my business pitch. The content needed are marketing validation, financial projection, competitor analysis. Would like to seek for your advice

    $2571 (Avg Bid)
    $2571 Giá đặt trung bình
    1 lượt đặt giá

    I want an expert in power system analysis to help me with my project. and he must know the power world program so well

    $131 (Avg Bid)
    $131 Giá đặt trung bình
    9 lượt đặt giá

    I need someone who can pull data (need to write a code in python to pull the data from the website and automate it). once you have the data then you need to analyze it, I will discuss those points in PM and finally prepare the presentation and provide recommendations. Thanks

    $99 (Avg Bid)
    $99 Giá đặt trung bình
    13 lượt đặt giá

    I am badly in need of someone who can convert written images to PDF documents I will pay such person very well

    $334 (Avg Bid)
    $334 Giá đặt trung bình
    22 lượt đặt giá

    I need a professional who can handle microsoft word packages and power point presentation including excel packages, to handle office files

    $376 (Avg Bid)
    $376 Giá đặt trung bình
    15 lượt đặt giá

    You need to be familiar with sorting algorithms, their time complexity, analysis etc. 1. Algorithms (definition, analysis, complexity etc.). 2. Sorting including mergesort, quicksort, heapsort and related questions like heapification etc. 3. Dynamic programming algorithms including knapsack, matrix chain, longest common subsequence, transitive closure, recurrences.

    $67 (Avg Bid)
    $67 Giá đặt trung bình
    11 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $502 - $1004
    $502 - $1004
    0 lượt đặt giá

    Milestone1: Upto 2-3 Pages It should contain the following. 1. Project charter 2. Problem statement – Existing problem or Goal statement – New / Idea 3. Business case Why is this project worth doing now? What are the consequences of not doing this project? Declare processes on the basis of priority (high , medium & low). It shoul...

    $72 (Avg Bid)
    $72 Giá đặt trung bình
    5 lượt đặt giá

    We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...

    $282 (Avg Bid)
    $282 Giá đặt trung bình
    9 lượt đặt giá

    In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...

    $36 (Avg Bid)
    $36 Giá đặt trung bình
    1 lượt đặt giá

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    $111 (Avg Bid)
    $111 Giá đặt trung bình
    23 lượt đặt giá
    Finance project 6 ngày left
    ĐÃ XÁC THỰC

    I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10

    $18 (Avg Bid)
    $18 Giá đặt trung bình
    14 lượt đặt giá
    Article analysis 6 ngày left
    ĐÃ XÁC THỰC

    Article analysis following certain criteria.

    $22 (Avg Bid)
    $22 Giá đặt trung bình
    31 lượt đặt giá

    What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...

    $101 (Avg Bid)
    $101 Giá đặt trung bình
    20 lượt đặt giá

    The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...

    $212 (Avg Bid)
    $212 Giá đặt trung bình
    13 lượt đặt giá
    sistema ERP 6 ngày left

    Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...

    $4600 (Avg Bid)
    $4600 Giá đặt trung bình
    5 lượt đặt giá

    I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.

    $99 (Avg Bid)
    $99 Giá đặt trung bình
    20 lượt đặt giá

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $134 (Avg Bid)
    $134 Giá đặt trung bình
    15 lượt đặt giá

    Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.

    $27 (Avg Bid)
    $27 Giá đặt trung bình
    5 lượt đặt giá

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $188 (Avg Bid)
    $188 Giá đặt trung bình
    27 lượt đặt giá
    alice programming 6 ngày left

    alice programming Create an animation using the techniques we have learned this term. The content and theme are completely up to you. As you should have been thinking/working on this project most of the term my expectations are very high. If you need inspiration you can use one of the exercises from the end of Chapter 4. Use comments liberally to describe what the code is doing. Use at least one ...

    $40 (Avg Bid)
    $40 Giá đặt trung bình
    1 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 lượt đặt giá

    Required Skills: Experience with modern JavaScript frameworks: React, Redux, [đăng nhập để xem URL], Node.js Experience with front-end tooling: SASS, Gulp, Webpack, Babel Database: MySQL, Cassandra, PostgreSQL, CoachroadDB, CouchDB Experience in RESTful API development and working with third-party APIs Knowledge of backend frameworks such as Express, Laravel/Django Utilize responsive design and we...

    $2820 (Avg Bid)
    $2820 Giá đặt trung bình
    9 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 lượt đặt giá

    I have a data analysis task.i am very honest

    $3 / hr (Avg Bid)
    $3 / hr Giá đặt trung bình
    7 lượt đặt giá
    Genomics Variants Exploration -- 2 6 ngày left
    ĐÃ XÁC THỰC

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $6 / hr (Avg Bid)
    $6 / hr Giá đặt trung bình
    3 lượt đặt giá
    data processing 6 ngày left

    I have a data analysis task. I needed someone who can help me with this

    $2340 (Avg Bid)
    $2340 Giá đặt trung bình
    13 lượt đặt giá

    The design of street lights using solar energy.

    $170 (Avg Bid)
    $170 Giá đặt trung bình
    11 lượt đặt giá

    This position is responsible for coding, configuration, testing, system performance optimization, and interoperability issues. The Software Developer will work with business product owners, developers, and quality analysts to drive value delivery and will participate in all phases of Agile software development. As a Senior .NET Development Consultant, you will work closely with our clients and tec...

    $16 / hr (Avg Bid)
    $16 / hr Giá đặt trung bình
    10 lượt đặt giá

    I show you a classification problem where you have a dataframe with 24 features and a target column with 5 categories (0,1,2,3,4) The challenge is: To Do all data analysis at your free election to understand what features could be the best to include in our model to get the higher evaluation metric Select those features that best will perform in our model At your free election do any feature eng...

    $121 (Avg Bid)
    $121 Giá đặt trung bình
    6 lượt đặt giá

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $81 (Avg Bid)
    $81 Giá đặt trung bình
    6 lượt đặt giá

    The research gap analysis requires you to study at least fifteen (15) related and recent papers presented at relevant conferences and journals. These should be related to IoT underpinning technologies, tools and models. The objective is to help you to review and evaluate state-of-the-art in IoT [đăng nhập để xem URL] avenues such as relevant IEEE conferences or Journals as well as Elsevier’s...

    $159 (Avg Bid)
    $159 Giá đặt trung bình
    14 lượt đặt giá

    1. Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    $266 (Avg Bid)
    $266 Giá đặt trung bình
    20 lượt đặt giá

    I have a data analysis actually need a person that will be taking care of my business on my behalf

    $30 / hr (Avg Bid)
    $30 / hr Giá đặt trung bình
    15 lượt đặt giá

    A SAP expert require ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    $194 (Avg Bid)
    $194 Giá đặt trung bình
    6 lượt đặt giá

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    $59 (Avg Bid)
    $59 Giá đặt trung bình
    22 lượt đặt giá

    financial and accounting, financial modeling, CFA, CPA, CIMA, stock market analysis, fundamental and technical analysis.

    $17 (Avg Bid)
    $17 Giá đặt trung bình
    5 lượt đặt giá

    The project is about constructing a glove factory from start to end. Below are the required things to be mentioned: • Introduction: Description of the company, nature of business, list of past awarded projects, etc. • Project details: Description, purpose, duration, location, etc. • Project selection model: Financial model or scoring model in calculation. • Project scope manag...

    $157 (Avg Bid)
    $157 Giá đặt trung bình
    4 lượt đặt giá

    write a report for these topics : 1- Risk and Sensitivity Analysis 2- Economic Analysis in Public Service Sector the refference will be attached

    $26 (Avg Bid)
    $26 Giá đặt trung bình
    25 lượt đặt giá

    The aim of research: To investigate and evaluate the frequency and reasons of new diagnosed trauma cases and its association with seasons among my fellow university students Objectives: 1. To investigate frequency of newly diagnosed trauma cases by gender and faculties 2. To evaluate and compare the frequency of newly diagnosed trauma cases by seasons (in the winter and summer) 3. ...

    $96 (Avg Bid)
    $96 Giá đặt trung bình
    8 lượt đặt giá