Pentaho analysiscông việc

Bộ lọc

Tìm kiếm gần đây của tôi
Lọc theo:
Ngân sách
đến
đến
đến
Loại
Nhiều kỹ năng
Ngôn ngữ
    Tình trạng công việc
    262 pentaho analysis công việc được tìm thấy, giá theo USD

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $123 (Avg Bid)
    $123 Giá đặt trung bình
    9 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $502 - $1004
    $502 - $1004
    0 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 lượt đặt giá

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    $20 - $167
    $20 - $167
    0 lượt đặt giá
    Static Analysis 6 ngày left

    Hi everyone, I need your help to create static analysis in Ansys Workbench. The motorcycle design was already meshed. The tasks will be, For the first time you can try to take displacements on the front wheel for x, y, z. and on the rear wheel y, and z. also set to zero displacements all revolute and translation joints . you will add gravity. And

    $18 (Avg Bid)
    $18 Giá đặt trung bình
    3 lượt đặt giá
    Genomics Variants Exploration -- 2 6 ngày left
    ĐÃ XÁC THỰC

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    $10 / hr (Avg Bid)
    $10 / hr Giá đặt trung bình
    1 lượt đặt giá
    data processing 6 ngày left

    I have a data analysis task. I needed someone who can help me with this

    $2373 (Avg Bid)
    $2373 Giá đặt trung bình
    9 lượt đặt giá

    The design of street lights using solar energy.

    $176 (Avg Bid)
    $176 Giá đặt trung bình
    11 lượt đặt giá

    ...reach your personal development goals. Key Responsibilities: • Full lifecycle application development • Design, code and debug software • Perform software analysis, risk analysis, reliability analysis • Participate in software modeling and simulation • Integrate new software solutions with existing systems • Extract and reverse engineer existi...

    $18 / hr (Avg Bid)
    $18 / hr Giá đặt trung bình
    7 lượt đặt giá

    I show you a classification problem where you have a dataframe with 24 features and a target column with 5 categories (0,1,2,3,4) The challenge is: To Do all data analysis at your free election to understand what features could be the best to include in our model to get the higher evaluation metric Select those features that best will perform in our

    $134 (Avg Bid)
    $134 Giá đặt trung bình
    5 lượt đặt giá

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    $81 (Avg Bid)
    $81 Giá đặt trung bình
    6 lượt đặt giá

    The research gap analysis requires you to study at least fifteen (15) related and recent papers presented at relevant conferences and journals. These should be related to IoT underpinning technologies, tools and models. The objective is to help you to review and evaluate state-of-the-art in IoT [đăng nhập để xem URL] avenues such as relevant IEEE conferences

    $158 (Avg Bid)
    $158 Giá đặt trung bình
    12 lượt đặt giá

    I have a data analysis actually need a person that will be taking care of my business on my behalf

    $30 / hr (Avg Bid)
    $30 / hr Giá đặt trung bình
    14 lượt đặt giá

    A SAP expert require ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    $169 (Avg Bid)
    $169 Giá đặt trung bình
    3 lượt đặt giá

    ...e)finally provide good ideas and plans for our project f)research on blogs etc..... 2)The freelancer must have good english communication skills 3)The freelancer must be good at analysis and decision making 4)Minimum budget only - one milestone per week and 2000 rupees per milestone 5)Increment after 3rd month aka training period (5000-10000 rupees per week)

    $63 (Avg Bid)
    $63 Giá đặt trung bình
    20 lượt đặt giá

    financial and accounting, financial modeling, CFA, CPA, CIMA, stock market analysis, fundamental and technical analysis.

    $11 (Avg Bid)
    $11 Giá đặt trung bình
    2 lượt đặt giá

    ...above. • Network diagram: Construct the diagram and identify the critical path. • Task duration: Expand diagram above with task duration. • Procurement: Process cycle and analysis with schedule bar chart. • Resource estimation: Costing with quantity of materials, machineries and manpower and resource histogram. • Cash flow statement: Construct a table

    $157 (Avg Bid)
    $157 Giá đặt trung bình
    4 lượt đặt giá

    The aim of research: To investigate and evaluate the frequency and reasons of new diagnosed trauma cases and its association with seasons among m...Methods: A cross-sectional online survey will be provided with a link by e-mail among participants whom are students currently attending a university or college. Correlation analysis will be carried out.

    $96 (Avg Bid)
    $96 Giá đặt trung bình
    8 lượt đặt giá
    shopify store 6 ngày left

    Hell...days - Video Ads for all products - Facebook Targeting and Ad Copy - Pricing & Profit - The retail price should not be over $30 with at least 4-5x profit margin - Competitors Analysis - Competitors should still be running the ads on their Facebook page - Also, products should not be scrapped from ecomhunt, niche scrapper or some other software!

    $504 (Avg Bid)
    $504 Giá đặt trung bình
    7 lượt đặt giá

    It's small project focused on how to analysis data by using Python.

    $20 (Avg Bid)
    $20 Giá đặt trung bình
    20 lượt đặt giá

    ...e)finally provide good ideas and plans for our project f)research on blogs etc..... 2)The freelancer must have good english communication skills 3)The freelancer must be good at analysis and decision making 4)Minimum budget only - one milestone per week and 2000 rupees per milestone 5)Increment after 3rd month aka training period (5000-10000 rupees per week)

    $58 (Avg Bid)
    $58 Giá đặt trung bình
    15 lượt đặt giá

    Need a website where users can get advice from experts in finance and investments. Also need some analysis about the number of visitors, their past experience with investment.

    $340 (Avg Bid)
    $340 Giá đặt trung bình
    9 lượt đặt giá

    I require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations. Skills Required

    $115 (Avg Bid)
    $115 Giá đặt trung bình
    11 lượt đặt giá

    It’s a civil engineering work, and require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural , model, drawings and comprobations.

    $72 (Avg Bid)
    $72 Giá đặt trung bình
    4 lượt đặt giá
    Hybris developer 6 ngày left
    ĐÃ XÁC THỰC

    ...JSP 2. Junits 3. Low level design documents 4. Unit test case documentation 5. Daily status 1. Will be working on assigned incidents/service-request/stories, doing impact analysis, preparing low level design, doing code changes, writing JUnits and unit testing as per project's development process for Medtronic's B2C and B2B sites. 2. Will be reporting

    $4929 (Avg Bid)
    $4929 Giá đặt trung bình
    4 lượt đặt giá
    voltage and current monitor and logger 6 ngày left
    ĐÃ XÁC THỰC

    - Require to build a voltage current and temperature...thermistor - Accuracy = 1degC - Range = 0-60degC - The circuit must read and store the values with 5 samples per second. - Ability to export the data in an Excel for further analysis Deliverables :- 1) Complete hardware design of circuit 2) MCU Software 3) Software to read the data on computer

    $424 (Avg Bid)
    $424 Giá đặt trung bình
    13 lượt đặt giá
    Angular.js & Java Dev Full Stack 6 ngày left
    ĐÃ XÁC THỰC

    ...jQuery. Hands-on experience with web services (REST & SOAP) Experience with Relational database technologies, T-SQL, and Microsoft SQL server Experience with object-oriented analysis and design techniques Expert with Java servers and framework such as Spring Boot, MyBatis or Hibernate, Tomcat, and REST API, JAX-RX, JAX-WS, JMS, JAVA MAIL, QARTZ There

    $22 / hr (Avg Bid)
    $22 / hr Giá đặt trung bình
    11 lượt đặt giá

    Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness

    $154 (Avg Bid)
    $154 Giá đặt trung bình
    12 lượt đặt giá

    Assalam-o-Alaikum Many greetings , I require a SAP expert ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    $129 (Avg Bid)
    $129 Giá đặt trung bình
    3 lượt đặt giá

    ...well, you will need to ensure your analysis clearly commworkplacecates your understanding of the tool/framework. Make sure you read the CRA as it will point to what you need to do to meet your grade aspirations. • Propose a recommendation or “course of action” that addresses the ethical dilemma. Based on your analysis, you then need to provide a clear

    $222 (Avg Bid)
    $222 Giá đặt trung bình
    18 lượt đặt giá
    AWS windows server - IIS expert 6 ngày left
    ĐÃ XÁC THỰC

    We are facing some challenges on AWS side. Our webservers are consuming CPU to 100 % even if we are upgrading it. Website is on dot net platform. Need expert to do analysis and suggest us what is exactly a problem and what we should to avoid it.

    $309 (Avg Bid)
    $309 Giá đặt trung bình
    7 lượt đặt giá

    I have a data analysis task need a data entry clerk

    $666 (Avg Bid)
    $666 Giá đặt trung bình
    28 lượt đặt giá
    Creative writing books/film review 6 ngày left
    ĐÃ XÁC THỰC

    5000 words analysis 4 following books and film: - The Merchant of Venice - William Shakespeare - Max - Sarah Cohen-Scali - The Pianist (film) - Roman Polanski - The Book Thief - Markis Zusak Discuss more if you're able to do. Budget: 100nzd

    $63 (Avg Bid)
    $63 Giá đặt trung bình
    27 lượt đặt giá

    ...software (X-plane, Merlin, Desktop controls, Microsoft FS) undertake a flight test exercise of a Cessna 172. Submit a formal lab report investigating the following: Flight-test analysis of the following manoeuvres, critically analysing what is happening to the aircraft. 1: Power-off stall in a turn with 25 degrees of flap to represent a stall turning from

    $510 (Avg Bid)
    $510 Giá đặt trung bình
    3 lượt đặt giá
    Optical communication system project 6 ngày left
    ĐÃ XÁC THỰC

    design Optical fibre communication system using MATLAB,write and analysis on that

    $303 (Avg Bid)
    $303 Giá đặt trung bình
    5 lượt đặt giá

    Being a professional quantitative data analysis provider, I offer the following services: #Descriptive analysis of survey data with SPSS # Inferrential analysis of survey data with SPSS # Produce model with Smartpls # Present the value of the mean, median, Cronbach's, T-test, Pearson Test, Reliability Test, etc. I will ensure the credibility and trustworthiness

    $462 (Avg Bid)
    $462 Giá đặt trung bình
    4 lượt đặt giá
    Qualitative Data Analysis with NVIVO-12 6 ngày left
    ĐÃ XÁC THỰC

    I have experience for more than 5 years doing qualitative data analysis with NVIVO. The service included: #Analysis data from Interview, FGD, Field Notes, Observation, and any text # Interview (Audio Transcription) #Content and Thematic Analysis # Producing tables, charts, maps, and figures of the themes # Producing word cloud #Produce Framework metrics

    $400 (Avg Bid)
    $400 Giá đặt trung bình
    1 lượt đặt giá
    Simulation by arena -- 2 6 ngày left
    ĐÃ XÁC THỰC

    Need help with the software for data entering and analysis

    $35 (Avg Bid)
    $35 Giá đặt trung bình
    1 lượt đặt giá
    Statistical Data Analysis 6 ngày left
    ĐÃ XÁC THỰC

    A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, so the firm will continue to use Supplier A unless they have significant evidence that the mean delivery time for Supplier B is lower. The SAS data set [đăng nhập để xem URL] contains data relating to a representative sample of 80 deliveries, 50 by supplier A and 30 ...

    $29 (Avg Bid)
    $29 Giá đặt trung bình
    5 lượt đặt giá

    Create an ETL that inserts a JPG, PNG, TIF or PDF image into an ElasticSearch field. Today we use PHP to upload the image and write it within ElasticSearch. I need ETL to take any file and insert it into the ElasticSearch index. Simple. I just need the writing mechanism and I will adjust the ETL to my needs.

    $35 (Avg Bid)
    $35 Giá đặt trung bình
    1 lượt đặt giá
    Financial Analysis 6 ngày left
    ĐÃ XÁC THỰC

    Financial analysis of a SME Enterprise.

    $372 (Avg Bid)
    $372 Giá đặt trung bình
    18 lượt đặt giá
    Compare and Contrast Essay 6 ngày left
    ĐÃ XÁC THỰC

    ...contrast essay is to observe, analyze, evaluate and explain the similarities and differences of two assigned poems. You will inform me, your audience, of your analysis. Be certain and strong in your analysis. The Organizational arrangement should be : Point by Point “A Dream Deferred” and “it was a dream” Langston Hughes and Lucille Clifton Option 1: Point-...

    $27 (Avg Bid)
    $27 Giá đặt trung bình
    25 lượt đặt giá
    Sas Data Analysis 6 ngày left
    ĐÃ XÁC THỰC

    A manufacturing firm currently receives supplies of raw materials from Supplier A. They have recently been approached by Supplier B, who has offered a more timely service. In order to investigate this claim, the firm has agreed to accept deliveries from Supplier B for a trial period in addition to those provided by Supplier A. The two suppliers have similar costs, so the firm will continue to use ...

    $30 (Avg Bid)
    $30 Giá đặt trung bình
    1 lượt đặt giá
    Digital Marketing Project 6 ngày left
    ĐÃ XÁC THỰC

    Powerpoint Slide Deck for marketing team Perform Data Analysis (on excel or other tools) and provide a good package of recommendations to business's marketing team KPI's and performance metrics

    $78 (Avg Bid)
    $78 Giá đặt trung bình
    20 lượt đặt giá
    Data Analysis project -- 2 6 ngày left
    ĐÃ XÁC THỰC

    :NOTE: PLEASE READ BEFORE BID, DON'T WASTE TIME ELSE I WILL REPORT TO FREELANCER.COM before awarding the project there will be dummy data assignments and 30 mins video interview. dummy data will involve all above but on a much smaller scale and the focus will be more on recommendation and executive summary. Hi, Please only bid if you can handle 2 projects simultaneously and meet tight deadli...

    $2462 (Avg Bid)
    $2462 Giá đặt trung bình
    14 lượt đặt giá
    Machine Learning 6 ngày left
    ĐÃ XÁC THỰC

    Analysis data by using Python

    $121 (Avg Bid)
    $121 Giá đặt trung bình
    28 lượt đặt giá

    We are looking for someone who can create Learning Videos for Youtube on - Basics of Stock Market - Fundamental Analysis - Technical Analysis

    $423 (Avg Bid)
    $423 Giá đặt trung bình
    11 lượt đặt giá
    Excel Expert 6 ngày left

    need some one to sort my data and help in analysis

    $22 (Avg Bid)
    $22 Giá đặt trung bình
    21 lượt đặt giá

    Need an engineer to develop an electric engine and bike frame for a motorcycle design I have. I will need CAD and analysis files along with manufacturing layouts and drawings for the bike.

    $565 (Avg Bid)
    $565 Giá đặt trung bình
    19 lượt đặt giá