Genetic code corrolated with sound (musical notes).

Having no programming knowledge I am at the mercy of chosen freelancer to decide which language would be most suitable for said project. All I know is that wanting to incorporate the application into a web-page would probably narrow down the choice of languages. On the other hand you may have none or very little knowledge of Biology and so I have tried to be as clear as possible in the description below, however I realise that it still may need extra explanation and would be happy provide it via email. An application which could produce a chip-tune style sound file output from a genetic input sequence (I realise this will just be a string of notes and not a harmonious melody). A nucleotide sequence would be pasted into the text box and then each codon (3 letter sequence) would be read and then turned into its corresponding note based on the universal genetic code (see codon chart below). The genetic code has 64 possible combinations of 3 letter nucleotides which would equate to 64 different notes and therefore be used to produce a sequence of notes based on the codons present. After calculation, said tune would play and an option to save the sound as a download would be given. It is important that the sounds used are of a very basic ‘computerised’8-bit sound type (which could be produced if the file contained the sound information and just played it using the computers default sound rendering on the chip perhaps rather than a library of set sounds?), i.e. not the sound of a sampled trumpet or piano. So this would play automatically, you would then have the choice to download a file which contained the note information and could be played in a media player as well as being able to import into a music production suite where the basic information in which notes playing at what time would be retained but the user could manipulate this in said software (can files like .midi do this? If so then the name could be changed to MIDI-Gene as this would be the file type generated, but this is something that would have to be decided afterwards.). The codons could be thought of as words, so a language with 64 3-letter words with each word being linked to its own individual note, the sentence (nucleotide sequence) would then be entered and a sound file produced based on the order of the words. The idea would be to host said application incorporated into a web page without the need to be run locally from downloaded software. GTA//CAG//ATA//GAC//AGA// TACAGATACGATCAGTACGCATGCTGCAA etc. An example sequence can be seen above. This would be pasted into the box and then each 3 letter word (separated with ‘//’ for clarity) would be read and in turn trigger the corresponding note. Apart from a few key details this is somewhat flexible. I would like a text entry box into which the nucleotide sequence is to be pasted and a go/run button to commence production of audio file. I would also like the name ‘CHIP-GENE’ or ‘MIDI-GENE’ (whichever), to be included, centred text at the top where a menu bar would normally be. I will be happy to answer any further questions and will be available for communication throughout the project via email. [The .pdf attachment contains the project proposal as well as the images (such as basic design idea) which are referenced throughout the above text]